Importance of Creative Industries in Economic Development
The definition of creative industries, economic value, and the role of creativity in modern economy are discussed in this content. Learn about the significance of creative tourism and its origins in cultural attractions. UNESCO's perspective on creative tourism is also highlighted.
Download Presentation
Please find below an Image/Link to download the presentation.
The content on the website is provided AS IS for your information and personal use only. It may not be sold, licensed, or shared on other websites without obtaining consent from the author.If you encounter any issues during the download, it is possible that the publisher has removed the file from their server.
You are allowed to download the files provided on this website for personal or commercial use, subject to the condition that they are used lawfully. All files are the property of their respective owners.
The content on the website is provided AS IS for your information and personal use only. It may not be sold, licensed, or shared on other websites without obtaining consent from the author.
E N D
Presentation Transcript
GenStore: A High-Performance In-Storage Processing System for Genome Sequence Analysis Session 6A: Thursday 3 March, 3:00 PM CEST Nika Mansouri Ghiasi, Jisung Park, Harun Mustafa, Jeremie Kim, Ataberk Olgun, Arvid Gollwitzer, Damla Senol Cali, Can Firtina, Haiyu Mao, Nour Almadhoun Alserr, Rachata Ausavarungnirun, Nandita Vijaykumar, Mohammed Alser, and Onur Mutlu
Genome Sequence Analysis Genome sequence analysis (GSA) is critical for many applications. - Personalized medicine - Outbreak tracing - Evolutionary studies Genome sequencing machines extract smaller fragments of the original DNA sequence, known as reads. AAGCTTCCATGG AAATGGGCTTTC GCTTCCAGAATG GCCCAAATGGTT 2
Genome Sequence Analysis Read mapping: First key step in genome sequence analysis - Aligns reads to potential matching locations in the reference genome Reference Genome GCCCATATGGTTAAGCTTCCATGGAAATGGGCTTTCGCTTCCACAATG Differences Differences GCCCAAATGGTT Read mapping requires computationally-expensive approximate string matching (ASM) to account for differences between reads and the reference genome due to: - Sequencing errors - Genetic Variation AAGCTTCCATGG GCTTCCAGAATG AAATGGGCTTTC 3
Genome Sequence Analysis Data Movement from Storage ASM Computation Unit (CPU or Accelerator) AAGCTTCCATGG GGGCCAGAATG CCTTTGGGTCCA Storage System CGTTCCTTGGCA Main Memory AAAATTCCATGG GAATGGGGCCA TCCCCGGGGCCA Cache TTTTTTCCAAAA GCTTCCAGAATG Computation overhead Data movement overhead 4
Improving the Performance of GSA Heuristics Accelerators Filters Computation Unit (CPU or Accelerator) AAGCTTCCATGG GGGCCAGAATG CCTTTGGGTCCA Storage System CGTTCCTTGGCA Main Memory AAAATTCCATGG GAATGGGGCCA TCCCCGGGGCCA Cache TTTTTTCCAAAA GCTTCCAGAATG Computation overhead Data movement overhead (The effect becomes even larger) 5
Key Idea Filter reads that do not require ASM inside the storage system Computation Unit (CPU or Accelerator) AAGCTTCCATGG GGGCCAGAATG CCTTTGGGTCCA CGTTCCTTGGCA Storage System TTTTTTCCAAAA GCTTCCAGAATG Main Memory AAAATTCCATGG GAATGGGGCCA TCCCCGGGGCCA Cache Filtered Reads Read mapping workloads can exhibit different behavior There are limited available hardware resources in the storage system 6
GenStore Filter reads that do not require ASM inside the storage system Computation Unit (CPU or Accelerator) Genstore-Enabled Storage System Main Memory Cache Computation overhead Data movement overhead GenStore provides significant speedup (1.4x - 33.6x) and energy reduction (3.9x 29.2x) at low cost 7
GenStore: A High-Performance In-Storage Processing System for Genome Sequence Analysis Session 6A: Thursday 3 March, 3:00 PM CEST Nika Mansouri Ghiasi (mnika@ethz.ch) Jisung Park, Harun Mustafa, Jeremie Kim, Ataberk Olgun, Arvid Gollwitzer, Damla Senol Cali, Can Firtina, Haiyu Mao, Nour Almadhoun Alserr, Rachata Ausavarungnirun, Nandita Vijaykumar, Mohammed Alser, and Onur Mutlu
