Using Ensembl SNP Data to Generate KASP Markers with PolyMarker

Download Presenatation
Using Ensembl SNP Data to Generate KASP Markers with PolyMarker
Slide Note
Embed
Share

Welcome to PolyMarker! This tool allows you to design your own primers or download pre-designed primers for SNP data from Ensembl. You can create KASP markers by uploading your .csv file containing SNP information, aligning parental sequences, and analyzing SNP markers found using Biomart. Understand the different symbols indicating varietal, homoeologous, genome-specific, and shared SNPs between parentals for effective marker design.

  • Ensembl SNP Data
  • PolyMarker
  • KASP Markers
  • Biomart
  • SNP Markers

Uploaded on Sep 20, 2024 | 0 Views


Download Presentation

Please find below an Image/Link to download the presentation.

The content on the website is provided AS IS for your information and personal use only. It may not be sold, licensed, or shared on other websites without obtaining consent from the author.If you encounter any issues during the download, it is possible that the publisher has removed the file from their server.

You are allowed to download the files provided on this website for personal or commercial use, subject to the condition that they are used lawfully. All files are the property of their respective owners.

The content on the website is provided AS IS for your information and personal use only. It may not be sold, licensed, or shared on other websites without obtaining consent from the author.

E N D

Presentation Transcript


  1. How to go from SNP data in Ensembl to getting KASP markers? Welcome to PolyMarker! http://polymarker.tgac.ac.uk/ Options: 1) Design your own primers 2) Download pre-designed primers for SNP data How to use Biomart to find SNP markers www.wheat-training.com

  2. Option 1: Design primers Upload your .csv file Enter your email address Name/ID , Chromosome , Sequence [SNP/SNP] Sequence Gene_1, 6B, ATGACGATACGGACGACA[A/T]ACGGGGGACGAGGG Gene_1,6B,GATAAGCGATGACGATACGGACGACA[A/T]ACGGGGGACGAGGGATACGAT How to use Biomart to find SNP markers www.wheat-training.com

  3. Create two separate input/parental sequences Align to Chinese spring survey sequence (CSS) How to use Biomart to find SNP markers www.wheat-training.com

  4. Create a mask that summarizes the assembly How to use Biomart to find SNP markers www.wheat-training.com

  5. & means a SNP between the two parentals is varietal, i.e. non-homoeologous; the SNP can be used for a KASP marker How to use Biomart to find SNP markers www.wheat-training.com

  6. A colon means a SNP between the two parentals is homoeologous, i.e. not useful to distinguish genomes SNP cannot be used for a KASP marker How to use Biomart to find SNP markers www.wheat-training.com

  7. A capital letter means a SNP between the two parentals is specific to one genome; Here specific to 1AS How to use Biomart to find SNP markers www.wheat-training.com

  8. A lowercase letter means a SNP between the two parentals is semi-specific, i.e. shared by two genomes; here 1AS and 1DSHow to use Biomart to find SNP markers www.wheat-training.com

  9. How to use Biomart to find SNP markers www.wheat-training.com

  10. Non-homoeologous Chromosome semi-specific SNP is varietal Genome specific SNP Red Boxes around sequence denotes the boundaries of the designed primers How to use Biomart to find SNP markers www.wheat-training.com

  11. Homoeologous Chromosome non-specific SNP is homoeologous No specificity How to use Biomart to find SNP markers www.wheat-training.com

  12. http://polymarker.tgac.ac.uk/Markdown?md=DesignedPrimers Option 2: Use previously designed markers How to use Biomart to find SNP markers www.wheat-training.com

  13. Or get them from CerealsDB http://www.cerealsdb.uk.net/cerealgenomics/CerealsDB/KASP_primers_for_iSelect.php How to use Biomart to find SNP markers www.wheat-training.com

Related


More Related Content